{"_id":"568f20e49ebef90d0087277e","__v":19,"category":{"_id":"568f0e73bdb9260d00149d8c","pages":["568f0ea29ebef90d0087276a","568f0eafb700ce0d002f4a32","568f0ebbbdb9260d00149d8d","568f0edeb700ce0d002f4a34","568f0ef3bdb9260d00149d8f","568f12099ebef90d0087276d","568f121abeb2700d00471839","568f20e49ebef90d0087277e","568f446d9ebef90d0087278f","56c79a728bf67e0d00734767","56cb8830c675f50b00a4b834","56d47e99a4a9211b00c8f0d2","56d4af6c1c4de4130005d74e","56d52a131c4de4130005d80b","56de001b3db43f2000d9a765","56de1087f25ce60e002e31ad","56e314c46e602e0e00700b35"],"__v":17,"project":"5476bf0f817e8d080031f988","version":"5476bf10817e8d080031f98b","sync":{"url":"","isSync":false},"reference":false,"createdAt":"2016-01-08T01:18:43.343Z","from_sync":false,"order":1,"slug":"protocols","title":"Premade Protocols"},"parentDoc":null,"project":"5476bf0f817e8d080031f988","user":"568ed50cbeb2700d00471802","version":{"_id":"5476bf10817e8d080031f98b","__v":18,"project":"5476bf0f817e8d080031f988","createdAt":"2014-11-27T06:05:04.263Z","releaseDate":"2014-11-27T06:05:04.263Z","categories":["5476bf10817e8d080031f98c","5477c46cf3736008009e9eb5","5477c474f3736008009e9eb6","5477c47ef3736008009e9eb7","5477c48ff3736008009e9eb8","5477c4948deb230800808bf0","54e68328154f8e0d0007b55c","54e90194c8e0c00d007ac061","54eed2275bf74a0d00ef4076","54f7a7be0a3cbb0d00d666fb","559b0ebf7ae7f80d0096d871","55d697f9ae529e0d00d34f03","562d4dcc8c6e5a0d00d6ed1d","562e591c4376430d006f17e0","568f0e73bdb9260d00149d8c","5719542aac1e2e0e001834c6","57a14a8ed778850e0047e230","5b05b198101d1c000303f938"],"is_deprecated":false,"is_hidden":false,"is_beta":false,"is_stable":true,"codename":"","version_clean":"1.0.0","version":"1.0"},"updates":[],"next":{"pages":[],"description":""},"createdAt":"2016-01-08T02:37:24.142Z","link_external":false,"link_url":"","githubsync":"","sync_unique":"","hidden":true,"api":{"results":{"codes":[]},"settings":"","auth":"required","params":[],"url":""},"isReference":false,"order":8,"body":"[block:callout]\n{\n  \"type\": \"success\",\n  \"title\": \"This is a validated protocol\",\n  \"body\": \"View the validation data [here](http://learn.transcriptic.com/oligosynthesis/)\"\n}\n[/block]\n\n[block:api-header]\n{\n  \"type\": \"basic\",\n  \"title\": \"Description\"\n}\n[/block]\nThis protocol orders DNA primers to be synthesized for use at Transcriptic. DNA is synthesized by [IDT](https://www.idtdna.com/site) and will be available in your inventory once it is received and diluted per the experimental parameters.\n[block:callout]\n{\n  \"type\": \"info\",\n  \"title\": \"gBlocks\",\n  \"body\": \"gBlocks are larger fragments of double-stranded​ DNA that can be synthesized by IDT. Currently, the Oligosynthesis protocol does not support gBlocks, however they can be ordered via IDT and shipped directly to Transcriptic. \\n\\nTo add gBlocks to your inventory, follow the method outlined in [this](https://www.youtube.com/watch?v=DjnpoIJ9QEA) video. Make a note of the individual 3 digit tube codes, and the 4 digit **Accessioning number** for the shipping address. \\n\\nNow go to IDT and order your gBlocks as you normally would, include the 3 digit labels at the end of the gBlock name in the order form. Next for the shipping address for the order use the address below but add your accessioning number\\n\\n**Transcriptic, Inc.\\nATTN: Accessioning (Your accession number)\\n3565 Haven Avenue,\\nSuite 3,\\nMenlo Park\\nCA 94025**\"\n}\n[/block]\n\n[block:api-header]\n{\n  \"type\": \"basic\",\n  \"title\": \"Sample requirements\"\n}\n[/block]\n\n[block:callout]\n{\n  \"type\": \"info\",\n  \"body\": \"\",\n  \"title\": \"This protocol does not require any sample inputs.\"\n}\n[/block]\n\n[block:api-header]\n{\n  \"type\": \"basic\",\n  \"title\": \"Required parameters\"\n}\n[/block]\n\n[block:callout]\n{\n  \"type\": \"warning\",\n  \"body\": \"Single oligonucleotides can be specified in the top portion of the protocol, however if you wish to synthesize a large number of oligonucleotides a bulk upload functionality is provided.\",\n  \"title\": \"There are two ways to import sequences to be synthesised\"\n}\n[/block]\n\n[block:image]\n{\n  \"images\": [\n    {\n      \"image\": [\n        \"https://files.readme.io/Rgi6hahdQnGQEGtoptqS_oligosynthesis_launcher.png\",\n        \"oligosynthesis_launcher.png\",\n        \"956\",\n        \"755\",\n        \"#57a0d9\",\n        \"\"\n      ],\n      \"caption\": \"A screenshot of the oligosynthesis protocol launcher.\"\n    }\n  ]\n}\n[/block]\n##Single Oligonucleotides\n\n`sequence` specifies the sequence of DNA you wish to be synthesized, for example, `ATGCGTAATCG`. `N` is also an acceptable character for any base.\n\n`scale` specifies the quantity of DNA you wish to synthesize. Options are 10 nmol, 25 nmol, 100 nmol, 250 nmol and 1 µmol. \n\n`purification` specifies how you wish your synthesized oligonucleotides to be purified. Choose from Standard, HPLC and PAGE.\n\n`oligonucleotide name` specifies the name of your sequence.\n\n`diluent` specifies the solvent you wish your oligonucleotides to be diluted in. Choose from deionized water or TE buffer.\n\n`concentration` specifies the final concentration you wish your oligonucleotides to be diluted to.\n\nMore information on `scale` and `purification` can be found on the [Oligosynthesis](doc:oligosynthesis) capabilities page.\n[block:callout]\n{\n  \"type\": \"info\",\n  \"title\": \"Add additional sequences\",\n  \"body\": \"If you wish to synthesize additional sequences click the `Add Oligonucleotide` link.\"\n}\n[/block]\n##Bulk Upload Sequences\n\n`sequence CSV` the `.csv` file you wish to upload that contains your sequence information. You can download a template of this [here](data:txt/csv,Label%2CSequence%2CScale%2CPurification%2CConcentration%2CDiluent%0D%0Asample_oligo1%2CCTATATCTTCATTACTCATCTATTACTT%2C10nm%2Cstandard%2C100uM%2Cwater).\n\n##Universal parameters\nThis parameter is required for either synthesis method.\n\n`storage condition for diluted oligonucleotides` the conditions that you wish your diluted oligonucleotides to be stored in. Choose from -20 or 4 degree celsius.\n[block:api-header]\n{\n  \"type\": \"basic\",\n  \"title\": \"Protocol Outputs\"\n}\n[/block]\nThis protocol out puts physical samples that will be visible in your inventory once the run completes. The storage condition of the samples will be dependent on what you specified in your protocol.\n[block:api-header]\n{\n  \"type\": \"basic\",\n  \"title\": \"Recommended guidelines\"\n}\n[/block]\nSequences can be difficult to synthesize for various reasons, including GC content, homopolymers, length and secondary structure. It is recommend you review synthesis guidelines from IDT to advise your sequence choices, which are accessible [here](https://www.idtdna.com/pages/support/technical-vault/faq/product/dna-rna-synthesis) \n[block:api-header]\n{\n  \"type\": \"basic\",\n  \"title\": \"Further reading\"\n}\n[/block]\n[IDT](https://www.idtdna.com)\n[IDT Oligonucleotide synthesis FAQ](https://www.idtdna.com/pages/support/technical-vault/faq/product/dna-rna-synthesis)\n[IDT Oligonucleotide purification FAQ](https://www.idtdna.com/pages/support/technical-vault/faq/product/purification) \n[block:callout]\n{\n  \"type\": \"success\",\n  \"body\": \"For further advice on your protocol please ask questions to the community at https://forum.transcriptic.com\",\n  \"title\": \"Check out the forum if you have more questions.\"\n}\n[/block]","excerpt":"","slug":"oligosynthesis-1","type":"basic","title":"Oligosynthesis"}
[block:callout] { "type": "success", "title": "This is a validated protocol", "body": "View the validation data [here](http://learn.transcriptic.com/oligosynthesis/)" } [/block] [block:api-header] { "type": "basic", "title": "Description" } [/block] This protocol orders DNA primers to be synthesized for use at Transcriptic. DNA is synthesized by [IDT](https://www.idtdna.com/site) and will be available in your inventory once it is received and diluted per the experimental parameters. [block:callout] { "type": "info", "title": "gBlocks", "body": "gBlocks are larger fragments of double-stranded​ DNA that can be synthesized by IDT. Currently, the Oligosynthesis protocol does not support gBlocks, however they can be ordered via IDT and shipped directly to Transcriptic. \n\nTo add gBlocks to your inventory, follow the method outlined in [this](https://www.youtube.com/watch?v=DjnpoIJ9QEA) video. Make a note of the individual 3 digit tube codes, and the 4 digit **Accessioning number** for the shipping address. \n\nNow go to IDT and order your gBlocks as you normally would, include the 3 digit labels at the end of the gBlock name in the order form. Next for the shipping address for the order use the address below but add your accessioning number\n\n**Transcriptic, Inc.\nATTN: Accessioning (Your accession number)\n3565 Haven Avenue,\nSuite 3,\nMenlo Park\nCA 94025**" } [/block] [block:api-header] { "type": "basic", "title": "Sample requirements" } [/block] [block:callout] { "type": "info", "body": "", "title": "This protocol does not require any sample inputs." } [/block] [block:api-header] { "type": "basic", "title": "Required parameters" } [/block] [block:callout] { "type": "warning", "body": "Single oligonucleotides can be specified in the top portion of the protocol, however if you wish to synthesize a large number of oligonucleotides a bulk upload functionality is provided.", "title": "There are two ways to import sequences to be synthesised" } [/block] [block:image] { "images": [ { "image": [ "https://files.readme.io/Rgi6hahdQnGQEGtoptqS_oligosynthesis_launcher.png", "oligosynthesis_launcher.png", "956", "755", "#57a0d9", "" ], "caption": "A screenshot of the oligosynthesis protocol launcher." } ] } [/block] ##Single Oligonucleotides `sequence` specifies the sequence of DNA you wish to be synthesized, for example, `ATGCGTAATCG`. `N` is also an acceptable character for any base. `scale` specifies the quantity of DNA you wish to synthesize. Options are 10 nmol, 25 nmol, 100 nmol, 250 nmol and 1 µmol. `purification` specifies how you wish your synthesized oligonucleotides to be purified. Choose from Standard, HPLC and PAGE. `oligonucleotide name` specifies the name of your sequence. `diluent` specifies the solvent you wish your oligonucleotides to be diluted in. Choose from deionized water or TE buffer. `concentration` specifies the final concentration you wish your oligonucleotides to be diluted to. More information on `scale` and `purification` can be found on the [Oligosynthesis](doc:oligosynthesis) capabilities page. [block:callout] { "type": "info", "title": "Add additional sequences", "body": "If you wish to synthesize additional sequences click the `Add Oligonucleotide` link." } [/block] ##Bulk Upload Sequences `sequence CSV` the `.csv` file you wish to upload that contains your sequence information. You can download a template of this [here](data:txt/csv,Label%2CSequence%2CScale%2CPurification%2CConcentration%2CDiluent%0D%0Asample_oligo1%2CCTATATCTTCATTACTCATCTATTACTT%2C10nm%2Cstandard%2C100uM%2Cwater). ##Universal parameters This parameter is required for either synthesis method. `storage condition for diluted oligonucleotides` the conditions that you wish your diluted oligonucleotides to be stored in. Choose from -20 or 4 degree celsius. [block:api-header] { "type": "basic", "title": "Protocol Outputs" } [/block] This protocol out puts physical samples that will be visible in your inventory once the run completes. The storage condition of the samples will be dependent on what you specified in your protocol. [block:api-header] { "type": "basic", "title": "Recommended guidelines" } [/block] Sequences can be difficult to synthesize for various reasons, including GC content, homopolymers, length and secondary structure. It is recommend you review synthesis guidelines from IDT to advise your sequence choices, which are accessible [here](https://www.idtdna.com/pages/support/technical-vault/faq/product/dna-rna-synthesis) [block:api-header] { "type": "basic", "title": "Further reading" } [/block] [IDT](https://www.idtdna.com) [IDT Oligonucleotide synthesis FAQ](https://www.idtdna.com/pages/support/technical-vault/faq/product/dna-rna-synthesis) [IDT Oligonucleotide purification FAQ](https://www.idtdna.com/pages/support/technical-vault/faq/product/purification) [block:callout] { "type": "success", "body": "For further advice on your protocol please ask questions to the community at https://forum.transcriptic.com", "title": "Check out the forum if you have more questions." } [/block]