{"__v":2,"_id":"571964f3e967cb1700d07a21","category":{"__v":2,"_id":"55d697f9ae529e0d00d34f03","pages":["55d698c5d2a8eb1900109ec5","56e204d4059d4a0e0034fa90"],"project":"5476bf0f817e8d080031f988","version":"5476bf10817e8d080031f98b","sync":{"url":"","isSync":false},"reference":true,"createdAt":"2015-08-21T03:16:09.287Z","from_sync":false,"order":9,"slug":"api-reference","title":"API REST end points"},"editedParams":true,"editedParams2":true,"parentDoc":null,"project":"5476bf0f817e8d080031f988","user":"568ed50cbeb2700d00471802","version":{"__v":17,"_id":"5476bf10817e8d080031f98b","project":"5476bf0f817e8d080031f988","createdAt":"2014-11-27T06:05:04.263Z","releaseDate":"2014-11-27T06:05:04.263Z","categories":["5476bf10817e8d080031f98c","5477c46cf3736008009e9eb5","5477c474f3736008009e9eb6","5477c47ef3736008009e9eb7","5477c48ff3736008009e9eb8","5477c4948deb230800808bf0","54e68328154f8e0d0007b55c","54e90194c8e0c00d007ac061","54eed2275bf74a0d00ef4076","54f7a7be0a3cbb0d00d666fb","559b0ebf7ae7f80d0096d871","55d697f9ae529e0d00d34f03","562d4dcc8c6e5a0d00d6ed1d","562e591c4376430d006f17e0","568f0e73bdb9260d00149d8c","5719542aac1e2e0e001834c6","57a14a8ed778850e0047e230"],"is_deprecated":false,"is_hidden":false,"is_beta":false,"is_stable":true,"codename":"","version_clean":"1.0.0","version":"1.0"},"updates":[],"next":{"pages":[],"description":""},"createdAt":"2016-04-21T23:40:35.061Z","link_external":false,"link_url":"","githubsync":"","sync_unique":"","hidden":false,"api":{"examples":{"codes":[{"code":"import requests\nimport json\n\nheaders = {\"X-User-Email\": 'example:::at:::example.com',\n           \"X-User-Token\": '',  # Regular-mode API key\n           \"Content-Type\": \"application/json\",\n           \"Accept\": \"application/json\"}\n\nurl = 'https://secure.transcriptic.com//:organization/protocols/:protocol_id/launch'\n\n# Create the request body, note statement of test mode boolean\nbody = json.dumps(\n  {\n   \"title\": \"My ligation run\", \n   \"parameters\": {\n      \"inputs\": {\n        \"reaction_setup\": {\n          \"inputs\": {\n            \"total_reaction_volume\": \"20:microliter\",\n            \"ligase_type\": \"thermo\",\n            \"ligase_vol\": \"1:microliter\",\n            \"gel\": true\n          }\n        },\n        \"reactions\": {\n          \"inputs\": {\n            \"fragments\": {\n              \"inputs\": {\n                \"fragment\": \"ctxxxxxxxxx/A1\",\n                \"volume\": \"5:microliter\"\n              }\n            }\n          }\n        },\n        \"lig\": [{\n          \"cycles\": 1,\n          \"steps\": [{\n            \"temperature\": \"22:celsius\",\n            \"duration\": \"30:minute\"\n          }]\n        }]\n      },\n      \"deact\": {\n        \"type\": \"thermocycle\",\n        \"label\": \"deactivation conditions\",\n        \"default\": [{\n          \"cycles\": 1,\n          \"steps\": [{\n            \"temperature\": \"65:celsius\",\n            \"duration\": \"10:minute\"\n          }]\n        }]\n      },\n      \"test_mode\": False\n    },\n   \"test_mode\": False\n  })\n\n# POST body to the run endpoint\nresponse = requests.post(url, body, headers=headers)","language":"python"}]},"results":{"codes":[{"status":200,"language":"json","code":"{\n  \"id\": \"lr18wrhb23k54vk\",\n  \"user_id\": \"u16r234n2393m\",\n  \"protocol_id\": \"pr18v9bpcsjn4p\",\n  \"inputs\": {\n    \"refs\": {\n      \"o397_10uM\": {\n        \"id\": \"ctl84ud9p7se2ug\",\n        \"label\": \"plasmid_dna\",\n        \"type\": \"micro-1.5\",\n        \"store\": \"cold_20\",\n        \"cover\": null,\n        \"aliquots\": {\n          \"0\": {\n            \"name\": \"plasmid_dna\",\n            \"volume\": \"94.8:microliter\",\n            \"properties\": {\n              \"Concentration\": \"10.00uM\",\n              \"Sequence\": \"actcgactagatcaggatcagagctagcatcgatcagct\"\n            }\n          }\n        }\n      }\n    },\n    \"parameters\": {\n      \"reaction_setup\": {\n        \"total_reaction_volume\": \"20:microliter\",\n        \"ligase_type\": \"thermo\",\n        \"ligase_vol\": \"1:microliter\",\n        \"gel\": true\n      },\n      \"reactions\": [\n        {\n          \"fragments\": [\n            {\n              \"fragment\": \"plasmid_dna/0\",\n              \"volume\": \"3:microliter\"\n            }\n          ]\n        }\n      ],\n      \"lig\": [\n        {\n          \"cycles\": 1,\n          \"steps\": [\n            {\n              \"temperature\": \"22:celsius\",\n              \"duration\": \"30:minute\"\n            }\n          ]\n        }\n      ],\n      \"deact\": [\n        {\n          \"cycles\": 1,\n          \"steps\": [\n            {\n              \"temperature\": \"65:celsius\",\n              \"duration\": \"10:minute\"\n            }\n          ]\n        }\n      ]\n    }\n  },\n  \"autoprotocol\": null,\n  \"generation_errors\": [],\n  \"progress\": 0,\n  \"created_at\": \"2016-04-21T17:20:44.839-07:00\",\n  \"updated_at\": \"2016-04-21T17:20:44.839-07:00\",\n  \"validated_at\": null,\n  \"test_mode\": false\n}","name":""}]},"settings":"","auth":"required","params":[{"_id":"5719667fe967cb1700d07a2c","ref":"","in":"path","required":false,"desc":"","default":"","type":"string","name":"organization"},{"_id":"5719667fe967cb1700d07a2b","ref":"","in":"path","required":false,"desc":"","default":"","type":"string","name":"protocol_id"}],"url":"/:organization/protocols/:protocol_id/launch"},"isReference":true,"order":9,"body":"[block:callout]\n{\n  \"type\": \"danger\",\n  \"title\": \"Experimental feature\"\n}\n[/block]\nThe launch_request_id from the response of this can then be used on the `/runs` `POST` end point to launch the run.","excerpt":"Programmatically launch a packaged protocol","slug":"protocolsprotocol_idlaunch","type":"post","title":"/protocols/:protocol_id/launch"}

post/protocols/:protocol_id/launch

Programmatically launch a packaged protocol

Definition

{{ api_url }}{{ page_api_url }}

Parameters

Path Params

organization:
string
protocol_id:
string

Examples


Result Format


Documentation

[block:callout] { "type": "danger", "title": "Experimental feature" } [/block] The launch_request_id from the response of this can then be used on the `/runs` `POST` end point to launch the run.

User Information

Try It Out

post
{{ tryResults.results }}
Method{{ tryResults.method }}
Request Headers
{{ tryResults.requestHeaders }}
URL{{ tryResults.url }}
Request Data
{{ tryResults.data }}
Status
Response Headers
{{ tryResults.responseHeaders }}